Review



b2m guide rna  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc b2m guide rna
    a Representative histograms showing OVA presentation on WT and <t>B2m</t> −/− B16-OVA cells upon IFN-γ treatment. b The abilities of CM and AECM from WT and B2m −/− B16-OVA cells (2 μg/mL) to stimulate OT-I T-cell proliferation (n = 3 independent experiments/group). c –e B16-OVA tumour growth curves were shown ( c , n = 5 mice/group). At day-29 post tumour inoculation, PBMCs were re-stimulated and the IFN-γ secretion by CD8 + T-cells were determined by ICS ( d , n = 4 mice/group), and tumour infiltrating CD8 + T-cells ( e , n = 4 mice for AECM@PC7A group, n = 5 mice for other groups) were measured. f Representative histograms showing MHC-I expression on WT and B2m −/− MC38 cells upon IFN-γ treatment. MC38 tumour growth curves were shown ( g , n = 5 mice/group). At day-28 post tumour inoculation, the IFN-γ secretion by CD8 + T-cells in PBMCs upon re-stimulation with Adpgk ( h ) or Rpl18 ( i ) neoantigen peptide was determined by ICS, and tumour infiltrating CD8 + T-cells ( j ) were measured (n = 5 mice/group). k B16-OVA tumour-bearing mice were i.t. vaccinated (black arrows), and received i.p. treatment of CD4, CD8 or isotype antibodies. Tumour growth curves were shown (n = 5 mice/group). l – n Splenic DCs were treated with B16-OVA derived nanovaccines (20 μg/mL) for 18 h, and MHC-I acquisitions was determined. Representative scatter plots ( l ) and the levels of acquired MHC-I as calculated by subtracting the MHC-I MFI from that of the untreated cells ( m ) for B2m −/− DCs were shown. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation ( n ) were determined (n = 3 independent experiments/group). o Splenic DCs were treated with indicated PC7A vaccines for 18 h. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation was measured (n = 3 independent experiments/group). p WT or B2m -/- mice were adoptively transferred with 2 × 10 5 OT-I T-cells, followed by s.c. vaccination 18 h later. The percentage of OT-1 CD8 + T-cells (CD8 + OVA Tetramer + ) in spleens was determined (n = 3 mice/group). In ( b – e , g – k , m –p ), q representative data from three independent experiments are presented as means ± s.e.m. Source data are provided as a file.
    B2m Guide Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b2m guide rna/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    b2m guide rna - by Bioz Stars, 2026-06
    94/100 stars

    Images

    1) Product Images from "Neoantigen enriched biomimetic nanovaccine for personalized cancer immunotherapy"

    Article Title: Neoantigen enriched biomimetic nanovaccine for personalized cancer immunotherapy

    Journal: Nature Communications

    doi: 10.1038/s41467-025-59977-8

    a Representative histograms showing OVA presentation on WT and B2m −/− B16-OVA cells upon IFN-γ treatment. b The abilities of CM and AECM from WT and B2m −/− B16-OVA cells (2 μg/mL) to stimulate OT-I T-cell proliferation (n = 3 independent experiments/group). c –e B16-OVA tumour growth curves were shown ( c , n = 5 mice/group). At day-29 post tumour inoculation, PBMCs were re-stimulated and the IFN-γ secretion by CD8 + T-cells were determined by ICS ( d , n = 4 mice/group), and tumour infiltrating CD8 + T-cells ( e , n = 4 mice for AECM@PC7A group, n = 5 mice for other groups) were measured. f Representative histograms showing MHC-I expression on WT and B2m −/− MC38 cells upon IFN-γ treatment. MC38 tumour growth curves were shown ( g , n = 5 mice/group). At day-28 post tumour inoculation, the IFN-γ secretion by CD8 + T-cells in PBMCs upon re-stimulation with Adpgk ( h ) or Rpl18 ( i ) neoantigen peptide was determined by ICS, and tumour infiltrating CD8 + T-cells ( j ) were measured (n = 5 mice/group). k B16-OVA tumour-bearing mice were i.t. vaccinated (black arrows), and received i.p. treatment of CD4, CD8 or isotype antibodies. Tumour growth curves were shown (n = 5 mice/group). l – n Splenic DCs were treated with B16-OVA derived nanovaccines (20 μg/mL) for 18 h, and MHC-I acquisitions was determined. Representative scatter plots ( l ) and the levels of acquired MHC-I as calculated by subtracting the MHC-I MFI from that of the untreated cells ( m ) for B2m −/− DCs were shown. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation ( n ) were determined (n = 3 independent experiments/group). o Splenic DCs were treated with indicated PC7A vaccines for 18 h. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation was measured (n = 3 independent experiments/group). p WT or B2m -/- mice were adoptively transferred with 2 × 10 5 OT-I T-cells, followed by s.c. vaccination 18 h later. The percentage of OT-1 CD8 + T-cells (CD8 + OVA Tetramer + ) in spleens was determined (n = 3 mice/group). In ( b – e , g – k , m –p ), q representative data from three independent experiments are presented as means ± s.e.m. Source data are provided as a file.
    Figure Legend Snippet: a Representative histograms showing OVA presentation on WT and B2m −/− B16-OVA cells upon IFN-γ treatment. b The abilities of CM and AECM from WT and B2m −/− B16-OVA cells (2 μg/mL) to stimulate OT-I T-cell proliferation (n = 3 independent experiments/group). c –e B16-OVA tumour growth curves were shown ( c , n = 5 mice/group). At day-29 post tumour inoculation, PBMCs were re-stimulated and the IFN-γ secretion by CD8 + T-cells were determined by ICS ( d , n = 4 mice/group), and tumour infiltrating CD8 + T-cells ( e , n = 4 mice for AECM@PC7A group, n = 5 mice for other groups) were measured. f Representative histograms showing MHC-I expression on WT and B2m −/− MC38 cells upon IFN-γ treatment. MC38 tumour growth curves were shown ( g , n = 5 mice/group). At day-28 post tumour inoculation, the IFN-γ secretion by CD8 + T-cells in PBMCs upon re-stimulation with Adpgk ( h ) or Rpl18 ( i ) neoantigen peptide was determined by ICS, and tumour infiltrating CD8 + T-cells ( j ) were measured (n = 5 mice/group). k B16-OVA tumour-bearing mice were i.t. vaccinated (black arrows), and received i.p. treatment of CD4, CD8 or isotype antibodies. Tumour growth curves were shown (n = 5 mice/group). l – n Splenic DCs were treated with B16-OVA derived nanovaccines (20 μg/mL) for 18 h, and MHC-I acquisitions was determined. Representative scatter plots ( l ) and the levels of acquired MHC-I as calculated by subtracting the MHC-I MFI from that of the untreated cells ( m ) for B2m −/− DCs were shown. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation ( n ) were determined (n = 3 independent experiments/group). o Splenic DCs were treated with indicated PC7A vaccines for 18 h. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation was measured (n = 3 independent experiments/group). p WT or B2m -/- mice were adoptively transferred with 2 × 10 5 OT-I T-cells, followed by s.c. vaccination 18 h later. The percentage of OT-1 CD8 + T-cells (CD8 + OVA Tetramer + ) in spleens was determined (n = 3 mice/group). In ( b – e , g – k , m –p ), q representative data from three independent experiments are presented as means ± s.e.m. Source data are provided as a file.

    Techniques Used: Expressing, Derivative Assay, Cell Culture, Vaccines



    Similar Products

    b2m single guide rna  (Synthego Inc)
    86
    Synthego Inc b2m single guide rna
    B2m Single Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b2m single guide rna/product/Synthego Inc
    Average 86 stars, based on 1 article reviews
    b2m single guide rna - by Bioz Stars, 2026-06
    86/100 stars
    		  Buy from Supplier
    b2m guide rna  (Addgene inc)
    94
    Addgene inc b2m guide rna
    a Representative histograms showing OVA presentation on WT and <t>B2m</t> −/− B16-OVA cells upon IFN-γ treatment. b The abilities of CM and AECM from WT and B2m −/− B16-OVA cells (2 μg/mL) to stimulate OT-I T-cell proliferation (n = 3 independent experiments/group). c –e B16-OVA tumour growth curves were shown ( c , n = 5 mice/group). At day-29 post tumour inoculation, PBMCs were re-stimulated and the IFN-γ secretion by CD8 + T-cells were determined by ICS ( d , n = 4 mice/group), and tumour infiltrating CD8 + T-cells ( e , n = 4 mice for AECM@PC7A group, n = 5 mice for other groups) were measured. f Representative histograms showing MHC-I expression on WT and B2m −/− MC38 cells upon IFN-γ treatment. MC38 tumour growth curves were shown ( g , n = 5 mice/group). At day-28 post tumour inoculation, the IFN-γ secretion by CD8 + T-cells in PBMCs upon re-stimulation with Adpgk ( h ) or Rpl18 ( i ) neoantigen peptide was determined by ICS, and tumour infiltrating CD8 + T-cells ( j ) were measured (n = 5 mice/group). k B16-OVA tumour-bearing mice were i.t. vaccinated (black arrows), and received i.p. treatment of CD4, CD8 or isotype antibodies. Tumour growth curves were shown (n = 5 mice/group). l – n Splenic DCs were treated with B16-OVA derived nanovaccines (20 μg/mL) for 18 h, and MHC-I acquisitions was determined. Representative scatter plots ( l ) and the levels of acquired MHC-I as calculated by subtracting the MHC-I MFI from that of the untreated cells ( m ) for B2m −/− DCs were shown. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation ( n ) were determined (n = 3 independent experiments/group). o Splenic DCs were treated with indicated PC7A vaccines for 18 h. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation was measured (n = 3 independent experiments/group). p WT or B2m -/- mice were adoptively transferred with 2 × 10 5 OT-I T-cells, followed by s.c. vaccination 18 h later. The percentage of OT-1 CD8 + T-cells (CD8 + OVA Tetramer + ) in spleens was determined (n = 3 mice/group). In ( b – e , g – k , m –p ), q representative data from three independent experiments are presented as means ± s.e.m. Source data are provided as a file.
    B2m Guide Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b2m guide rna/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    b2m guide rna - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    b2m(2)-specific guide rna  (GenScript corporation)
    90
    GenScript corporation b2m(2)-specific guide rna
    a Representative histograms showing OVA presentation on WT and <t>B2m</t> −/− B16-OVA cells upon IFN-γ treatment. b The abilities of CM and AECM from WT and B2m −/− B16-OVA cells (2 μg/mL) to stimulate OT-I T-cell proliferation (n = 3 independent experiments/group). c –e B16-OVA tumour growth curves were shown ( c , n = 5 mice/group). At day-29 post tumour inoculation, PBMCs were re-stimulated and the IFN-γ secretion by CD8 + T-cells were determined by ICS ( d , n = 4 mice/group), and tumour infiltrating CD8 + T-cells ( e , n = 4 mice for AECM@PC7A group, n = 5 mice for other groups) were measured. f Representative histograms showing MHC-I expression on WT and B2m −/− MC38 cells upon IFN-γ treatment. MC38 tumour growth curves were shown ( g , n = 5 mice/group). At day-28 post tumour inoculation, the IFN-γ secretion by CD8 + T-cells in PBMCs upon re-stimulation with Adpgk ( h ) or Rpl18 ( i ) neoantigen peptide was determined by ICS, and tumour infiltrating CD8 + T-cells ( j ) were measured (n = 5 mice/group). k B16-OVA tumour-bearing mice were i.t. vaccinated (black arrows), and received i.p. treatment of CD4, CD8 or isotype antibodies. Tumour growth curves were shown (n = 5 mice/group). l – n Splenic DCs were treated with B16-OVA derived nanovaccines (20 μg/mL) for 18 h, and MHC-I acquisitions was determined. Representative scatter plots ( l ) and the levels of acquired MHC-I as calculated by subtracting the MHC-I MFI from that of the untreated cells ( m ) for B2m −/− DCs were shown. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation ( n ) were determined (n = 3 independent experiments/group). o Splenic DCs were treated with indicated PC7A vaccines for 18 h. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation was measured (n = 3 independent experiments/group). p WT or B2m -/- mice were adoptively transferred with 2 × 10 5 OT-I T-cells, followed by s.c. vaccination 18 h later. The percentage of OT-1 CD8 + T-cells (CD8 + OVA Tetramer + ) in spleens was determined (n = 3 mice/group). In ( b – e , g – k , m –p ), q representative data from three independent experiments are presented as means ± s.e.m. Source data are provided as a file.
    B2m(2) Specific Guide Rna, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b2m(2)-specific guide rna/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    b2m(2)-specific guide rna - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    b2m(1)-specific guide rna  (GenScript corporation)
    90
    GenScript corporation b2m(1)-specific guide rna
    a Representative histograms showing OVA presentation on WT and <t>B2m</t> −/− B16-OVA cells upon IFN-γ treatment. b The abilities of CM and AECM from WT and B2m −/− B16-OVA cells (2 μg/mL) to stimulate OT-I T-cell proliferation (n = 3 independent experiments/group). c –e B16-OVA tumour growth curves were shown ( c , n = 5 mice/group). At day-29 post tumour inoculation, PBMCs were re-stimulated and the IFN-γ secretion by CD8 + T-cells were determined by ICS ( d , n = 4 mice/group), and tumour infiltrating CD8 + T-cells ( e , n = 4 mice for AECM@PC7A group, n = 5 mice for other groups) were measured. f Representative histograms showing MHC-I expression on WT and B2m −/− MC38 cells upon IFN-γ treatment. MC38 tumour growth curves were shown ( g , n = 5 mice/group). At day-28 post tumour inoculation, the IFN-γ secretion by CD8 + T-cells in PBMCs upon re-stimulation with Adpgk ( h ) or Rpl18 ( i ) neoantigen peptide was determined by ICS, and tumour infiltrating CD8 + T-cells ( j ) were measured (n = 5 mice/group). k B16-OVA tumour-bearing mice were i.t. vaccinated (black arrows), and received i.p. treatment of CD4, CD8 or isotype antibodies. Tumour growth curves were shown (n = 5 mice/group). l – n Splenic DCs were treated with B16-OVA derived nanovaccines (20 μg/mL) for 18 h, and MHC-I acquisitions was determined. Representative scatter plots ( l ) and the levels of acquired MHC-I as calculated by subtracting the MHC-I MFI from that of the untreated cells ( m ) for B2m −/− DCs were shown. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation ( n ) were determined (n = 3 independent experiments/group). o Splenic DCs were treated with indicated PC7A vaccines for 18 h. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation was measured (n = 3 independent experiments/group). p WT or B2m -/- mice were adoptively transferred with 2 × 10 5 OT-I T-cells, followed by s.c. vaccination 18 h later. The percentage of OT-1 CD8 + T-cells (CD8 + OVA Tetramer + ) in spleens was determined (n = 3 mice/group). In ( b – e , g – k , m –p ), q representative data from three independent experiments are presented as means ± s.e.m. Source data are provided as a file.
    B2m(1) Specific Guide Rna, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b2m(1)-specific guide rna/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    b2m(1)-specific guide rna - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    b2m ko raji cell line guide rna  (Synthego Inc)
    90
    Synthego Inc b2m ko raji cell line guide rna
    a NK cell viability after thawing assessed via flow cytometry ( n = 5 healthy donors). b NK cell recovery 24, 48, and 72 h after thawing in comparison to starting NK cell number at time 0 h after thawing ( n = 10 healthy donors). c CD107A degranulation assay before and after thawing. NK cells were cultured with K562 cells at 1:1 effector:target ratio for 3 h ( n = 4 healthy donors). d NK cytotoxicity assay before and after cryopreservation with <t>B2M</t> KO <t>Raji</t> cells ( n = 4 healthy donors). e NK cytotoxicity assay before and after cryopreservation with K562 cells ( n = 4 healthy donors). f ADCC assay using anti-CD20 antibody and Jeko-1 cells ( n = 3 healthy donors). g Single-cell secretome profile of cryopreserved and non-cryopreserved NK cells treated with R848 for 24 h). Heatmap showing individual cytokines that NK cell secreted ( n = 3 healthy donors). h Bulk <t>RNA</t> volcano plot comparing before, 24 and 72 h after cryopreservation ( n = 5 healthy donors). i GSEA of IL-2-STAT5 pathway. Normality test was used to determine the distribution of the data then parametric test t test was used for ( a , c ). Two-way RM ANOVA was used for ( d – f ). The Benjamini–Hochberg method was used to obtain P value shown in ( h ). A two-tailed test was used for ( a , c , h ). g Error bars are shown as mean SD. All other graphs are shown as mean ± SEM.
    B2m Ko Raji Cell Line Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b2m ko raji cell line guide rna/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    b2m ko raji cell line guide rna - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    ipsc engineering guide rna targeting the b2m locus  (Synthego Inc)
    90
    Synthego Inc ipsc engineering guide rna targeting the b2m locus
    a NK cell viability after thawing assessed via flow cytometry ( n = 5 healthy donors). b NK cell recovery 24, 48, and 72 h after thawing in comparison to starting NK cell number at time 0 h after thawing ( n = 10 healthy donors). c CD107A degranulation assay before and after thawing. NK cells were cultured with K562 cells at 1:1 effector:target ratio for 3 h ( n = 4 healthy donors). d NK cytotoxicity assay before and after cryopreservation with <t>B2M</t> KO <t>Raji</t> cells ( n = 4 healthy donors). e NK cytotoxicity assay before and after cryopreservation with K562 cells ( n = 4 healthy donors). f ADCC assay using anti-CD20 antibody and Jeko-1 cells ( n = 3 healthy donors). g Single-cell secretome profile of cryopreserved and non-cryopreserved NK cells treated with R848 for 24 h). Heatmap showing individual cytokines that NK cell secreted ( n = 3 healthy donors). h Bulk <t>RNA</t> volcano plot comparing before, 24 and 72 h after cryopreservation ( n = 5 healthy donors). i GSEA of IL-2-STAT5 pathway. Normality test was used to determine the distribution of the data then parametric test t test was used for ( a , c ). Two-way RM ANOVA was used for ( d – f ). The Benjamini–Hochberg method was used to obtain P value shown in ( h ). A two-tailed test was used for ( a , c , h ). g Error bars are shown as mean SD. All other graphs are shown as mean ± SEM.
    Ipsc Engineering Guide Rna Targeting The B2m Locus, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ipsc engineering guide rna targeting the b2m locus/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    ipsc engineering guide rna targeting the b2m locus - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    b2m single guide rna plasmid  (OriGene)
    90
    OriGene b2m single guide rna plasmid
    a NK cell viability after thawing assessed via flow cytometry ( n = 5 healthy donors). b NK cell recovery 24, 48, and 72 h after thawing in comparison to starting NK cell number at time 0 h after thawing ( n = 10 healthy donors). c CD107A degranulation assay before and after thawing. NK cells were cultured with K562 cells at 1:1 effector:target ratio for 3 h ( n = 4 healthy donors). d NK cytotoxicity assay before and after cryopreservation with <t>B2M</t> KO <t>Raji</t> cells ( n = 4 healthy donors). e NK cytotoxicity assay before and after cryopreservation with K562 cells ( n = 4 healthy donors). f ADCC assay using anti-CD20 antibody and Jeko-1 cells ( n = 3 healthy donors). g Single-cell secretome profile of cryopreserved and non-cryopreserved NK cells treated with R848 for 24 h). Heatmap showing individual cytokines that NK cell secreted ( n = 3 healthy donors). h Bulk <t>RNA</t> volcano plot comparing before, 24 and 72 h after cryopreservation ( n = 5 healthy donors). i GSEA of IL-2-STAT5 pathway. Normality test was used to determine the distribution of the data then parametric test t test was used for ( a , c ). Two-way RM ANOVA was used for ( d – f ). The Benjamini–Hochberg method was used to obtain P value shown in ( h ). A two-tailed test was used for ( a , c , h ). g Error bars are shown as mean SD. All other graphs are shown as mean ± SEM.
    B2m Single Guide Rna Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b2m single guide rna plasmid/product/OriGene
    Average 90 stars, based on 1 article reviews
    b2m single guide rna plasmid - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    b2m single-guide rna  (Synthego Inc)
    90
    Synthego Inc b2m single-guide rna
    ( A ) Scheme of retroviral vectors containing the survivin-specific TCR (top, TCR) or the combination of TCR and CD8αβ and the selectable marker gene ΔCD271 (bottom, TCR8). ( B and C ) Determination of monomeric dissociation kinetics with survivin-specific reversible NTAmers. ( B ) Representative analysis of temperature-controlled (4°C) pMHC-TCR or pMHC-TCR8 monomeric dissociation rates. No NTAmer staining in TCR + CD4 + T cells; ND, not detected. ( C ) Summary of monomeric dissociation constants [ k off (s −1 )], n = 3 donors, three independent experiments with technical replicates. Mean ± SD, P = NS, one-way analysis of variance (ANOVA) test. ( D and E ) Analysis of early TCR signaling events. ( D ) Representative FACS histograms of pLCK-Y394 phosphorylation NT (gray), TCR + (blue), and TCR8 + (green) CD4 + or CD8 + T cells. ( E ) Summary of pLCK MFI normalized to MFI in NT control cells. n = 4 donors, mean ± SD, CD4: TCR + versus TCR8 + : 104 ± 11% versus 173 ± 35%, CD8: TCR + versus TCR8 + : 106 ± 7% versus 126 ± 13%, TCR8 + CD8 versus CD4: 126 ± 13% versus 173 ± 35%. NS, not significant, * P < 0.05. ( F ) Antigen sensitivity measured by IFN-γ ELISpot against peptide-pulsed T2 cells. SFC, spot-forming cells, n = 3 donors, three technical replicates each, mean ± SD, nonlinear regression (curve fit). ( G ) Coculture of NT, TCR + , or TCR8 + CD4 + (red bars) or CD8 + (black bars) T cells with BV173 leukemia cells (HLA-A2*02:01 + survivin + ); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 7. ( H ) Coculture of NT, TCR + , or TCR8 + CD4 + (left) or CD8 + (right) T cells with wild-type (WT) BV173 (solid bars) or β2-microglobulin knockout <t>(B2M-KO)</t> BV173 cells (open bars); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 3. Mean ± SD, *** P < 0.001 and **** P < 0.0001. t test on log-transformed data.
    B2m Single Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b2m single-guide rna/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    b2m single-guide rna - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    a Representative histograms showing OVA presentation on WT and B2m −/− B16-OVA cells upon IFN-γ treatment. b The abilities of CM and AECM from WT and B2m −/− B16-OVA cells (2 μg/mL) to stimulate OT-I T-cell proliferation (n = 3 independent experiments/group). c –e B16-OVA tumour growth curves were shown ( c , n = 5 mice/group). At day-29 post tumour inoculation, PBMCs were re-stimulated and the IFN-γ secretion by CD8 + T-cells were determined by ICS ( d , n = 4 mice/group), and tumour infiltrating CD8 + T-cells ( e , n = 4 mice for AECM@PC7A group, n = 5 mice for other groups) were measured. f Representative histograms showing MHC-I expression on WT and B2m −/− MC38 cells upon IFN-γ treatment. MC38 tumour growth curves were shown ( g , n = 5 mice/group). At day-28 post tumour inoculation, the IFN-γ secretion by CD8 + T-cells in PBMCs upon re-stimulation with Adpgk ( h ) or Rpl18 ( i ) neoantigen peptide was determined by ICS, and tumour infiltrating CD8 + T-cells ( j ) were measured (n = 5 mice/group). k B16-OVA tumour-bearing mice were i.t. vaccinated (black arrows), and received i.p. treatment of CD4, CD8 or isotype antibodies. Tumour growth curves were shown (n = 5 mice/group). l – n Splenic DCs were treated with B16-OVA derived nanovaccines (20 μg/mL) for 18 h, and MHC-I acquisitions was determined. Representative scatter plots ( l ) and the levels of acquired MHC-I as calculated by subtracting the MHC-I MFI from that of the untreated cells ( m ) for B2m −/− DCs were shown. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation ( n ) were determined (n = 3 independent experiments/group). o Splenic DCs were treated with indicated PC7A vaccines for 18 h. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation was measured (n = 3 independent experiments/group). p WT or B2m -/- mice were adoptively transferred with 2 × 10 5 OT-I T-cells, followed by s.c. vaccination 18 h later. The percentage of OT-1 CD8 + T-cells (CD8 + OVA Tetramer + ) in spleens was determined (n = 3 mice/group). In ( b – e , g – k , m –p ), q representative data from three independent experiments are presented as means ± s.e.m. Source data are provided as a file.

    Journal: Nature Communications

    Article Title: Neoantigen enriched biomimetic nanovaccine for personalized cancer immunotherapy

    doi: 10.1038/s41467-025-59977-8

    Figure Lengend Snippet: a Representative histograms showing OVA presentation on WT and B2m −/− B16-OVA cells upon IFN-γ treatment. b The abilities of CM and AECM from WT and B2m −/− B16-OVA cells (2 μg/mL) to stimulate OT-I T-cell proliferation (n = 3 independent experiments/group). c –e B16-OVA tumour growth curves were shown ( c , n = 5 mice/group). At day-29 post tumour inoculation, PBMCs were re-stimulated and the IFN-γ secretion by CD8 + T-cells were determined by ICS ( d , n = 4 mice/group), and tumour infiltrating CD8 + T-cells ( e , n = 4 mice for AECM@PC7A group, n = 5 mice for other groups) were measured. f Representative histograms showing MHC-I expression on WT and B2m −/− MC38 cells upon IFN-γ treatment. MC38 tumour growth curves were shown ( g , n = 5 mice/group). At day-28 post tumour inoculation, the IFN-γ secretion by CD8 + T-cells in PBMCs upon re-stimulation with Adpgk ( h ) or Rpl18 ( i ) neoantigen peptide was determined by ICS, and tumour infiltrating CD8 + T-cells ( j ) were measured (n = 5 mice/group). k B16-OVA tumour-bearing mice were i.t. vaccinated (black arrows), and received i.p. treatment of CD4, CD8 or isotype antibodies. Tumour growth curves were shown (n = 5 mice/group). l – n Splenic DCs were treated with B16-OVA derived nanovaccines (20 μg/mL) for 18 h, and MHC-I acquisitions was determined. Representative scatter plots ( l ) and the levels of acquired MHC-I as calculated by subtracting the MHC-I MFI from that of the untreated cells ( m ) for B2m −/− DCs were shown. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation ( n ) were determined (n = 3 independent experiments/group). o Splenic DCs were treated with indicated PC7A vaccines for 18 h. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation was measured (n = 3 independent experiments/group). p WT or B2m -/- mice were adoptively transferred with 2 × 10 5 OT-I T-cells, followed by s.c. vaccination 18 h later. The percentage of OT-1 CD8 + T-cells (CD8 + OVA Tetramer + ) in spleens was determined (n = 3 mice/group). In ( b – e , g – k , m –p ), q representative data from three independent experiments are presented as means ± s.e.m. Source data are provided as a file.

    Article Snippet: B2m guide RNA was constructed into lentiCRISPR v2 (Addgene #52961) with a targeting sequence of AGTATACTCACGCCACCCACCGG, and a non-targeting sequence of GTATTACTGATATTGGTGGG was set as control.

    Techniques: Expressing, Derivative Assay, Cell Culture, Vaccines

    a NK cell viability after thawing assessed via flow cytometry ( n = 5 healthy donors). b NK cell recovery 24, 48, and 72 h after thawing in comparison to starting NK cell number at time 0 h after thawing ( n = 10 healthy donors). c CD107A degranulation assay before and after thawing. NK cells were cultured with K562 cells at 1:1 effector:target ratio for 3 h ( n = 4 healthy donors). d NK cytotoxicity assay before and after cryopreservation with B2M KO Raji cells ( n = 4 healthy donors). e NK cytotoxicity assay before and after cryopreservation with K562 cells ( n = 4 healthy donors). f ADCC assay using anti-CD20 antibody and Jeko-1 cells ( n = 3 healthy donors). g Single-cell secretome profile of cryopreserved and non-cryopreserved NK cells treated with R848 for 24 h). Heatmap showing individual cytokines that NK cell secreted ( n = 3 healthy donors). h Bulk RNA volcano plot comparing before, 24 and 72 h after cryopreservation ( n = 5 healthy donors). i GSEA of IL-2-STAT5 pathway. Normality test was used to determine the distribution of the data then parametric test t test was used for ( a , c ). Two-way RM ANOVA was used for ( d – f ). The Benjamini–Hochberg method was used to obtain P value shown in ( h ). A two-tailed test was used for ( a , c , h ). g Error bars are shown as mean SD. All other graphs are shown as mean ± SEM.

    Journal: Nature Communications

    Article Title: Pretreatment with IL-15 and IL-18 rescues natural killer cells from granzyme B-mediated apoptosis after cryopreservation

    doi: 10.1038/s41467-024-47574-0

    Figure Lengend Snippet: a NK cell viability after thawing assessed via flow cytometry ( n = 5 healthy donors). b NK cell recovery 24, 48, and 72 h after thawing in comparison to starting NK cell number at time 0 h after thawing ( n = 10 healthy donors). c CD107A degranulation assay before and after thawing. NK cells were cultured with K562 cells at 1:1 effector:target ratio for 3 h ( n = 4 healthy donors). d NK cytotoxicity assay before and after cryopreservation with B2M KO Raji cells ( n = 4 healthy donors). e NK cytotoxicity assay before and after cryopreservation with K562 cells ( n = 4 healthy donors). f ADCC assay using anti-CD20 antibody and Jeko-1 cells ( n = 3 healthy donors). g Single-cell secretome profile of cryopreserved and non-cryopreserved NK cells treated with R848 for 24 h). Heatmap showing individual cytokines that NK cell secreted ( n = 3 healthy donors). h Bulk RNA volcano plot comparing before, 24 and 72 h after cryopreservation ( n = 5 healthy donors). i GSEA of IL-2-STAT5 pathway. Normality test was used to determine the distribution of the data then parametric test t test was used for ( a , c ). Two-way RM ANOVA was used for ( d – f ). The Benjamini–Hochberg method was used to obtain P value shown in ( h ). A two-tailed test was used for ( a , c , h ). g Error bars are shown as mean SD. All other graphs are shown as mean ± SEM.

    Article Snippet: To generate B2M KO Raji cell line guide RNA targeting B2M was purchased form Synthego and used with SpyFi Cas9 Nucleases (Aldevron# 9214-5MG). gRNA was mixed with Cas9 for 20 min at RT to form RNP complex and then electroporated into Raji cells using a LONZA 4D system with SF buffer (LONZA#V4LC-2520).

    Techniques: Flow Cytometry, Cell Recovery, Comparison, Degranulation Assay, Cell Culture, Cytotoxicity Assay, ADCC Assay, Two Tailed Test

    ( A ) Scheme of retroviral vectors containing the survivin-specific TCR (top, TCR) or the combination of TCR and CD8αβ and the selectable marker gene ΔCD271 (bottom, TCR8). ( B and C ) Determination of monomeric dissociation kinetics with survivin-specific reversible NTAmers. ( B ) Representative analysis of temperature-controlled (4°C) pMHC-TCR or pMHC-TCR8 monomeric dissociation rates. No NTAmer staining in TCR + CD4 + T cells; ND, not detected. ( C ) Summary of monomeric dissociation constants [ k off (s −1 )], n = 3 donors, three independent experiments with technical replicates. Mean ± SD, P = NS, one-way analysis of variance (ANOVA) test. ( D and E ) Analysis of early TCR signaling events. ( D ) Representative FACS histograms of pLCK-Y394 phosphorylation NT (gray), TCR + (blue), and TCR8 + (green) CD4 + or CD8 + T cells. ( E ) Summary of pLCK MFI normalized to MFI in NT control cells. n = 4 donors, mean ± SD, CD4: TCR + versus TCR8 + : 104 ± 11% versus 173 ± 35%, CD8: TCR + versus TCR8 + : 106 ± 7% versus 126 ± 13%, TCR8 + CD8 versus CD4: 126 ± 13% versus 173 ± 35%. NS, not significant, * P < 0.05. ( F ) Antigen sensitivity measured by IFN-γ ELISpot against peptide-pulsed T2 cells. SFC, spot-forming cells, n = 3 donors, three technical replicates each, mean ± SD, nonlinear regression (curve fit). ( G ) Coculture of NT, TCR + , or TCR8 + CD4 + (red bars) or CD8 + (black bars) T cells with BV173 leukemia cells (HLA-A2*02:01 + survivin + ); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 7. ( H ) Coculture of NT, TCR + , or TCR8 + CD4 + (left) or CD8 + (right) T cells with wild-type (WT) BV173 (solid bars) or β2-microglobulin knockout (B2M-KO) BV173 cells (open bars); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 3. Mean ± SD, *** P < 0.001 and **** P < 0.0001. t test on log-transformed data.

    Journal: Science Advances

    Article Title: Single-cell transcriptomics identifies multiple pathways underlying antitumor function of TCR- and CD8αβ-engineered human CD4 + T cells

    doi: 10.1126/sciadv.aaz7809

    Figure Lengend Snippet: ( A ) Scheme of retroviral vectors containing the survivin-specific TCR (top, TCR) or the combination of TCR and CD8αβ and the selectable marker gene ΔCD271 (bottom, TCR8). ( B and C ) Determination of monomeric dissociation kinetics with survivin-specific reversible NTAmers. ( B ) Representative analysis of temperature-controlled (4°C) pMHC-TCR or pMHC-TCR8 monomeric dissociation rates. No NTAmer staining in TCR + CD4 + T cells; ND, not detected. ( C ) Summary of monomeric dissociation constants [ k off (s −1 )], n = 3 donors, three independent experiments with technical replicates. Mean ± SD, P = NS, one-way analysis of variance (ANOVA) test. ( D and E ) Analysis of early TCR signaling events. ( D ) Representative FACS histograms of pLCK-Y394 phosphorylation NT (gray), TCR + (blue), and TCR8 + (green) CD4 + or CD8 + T cells. ( E ) Summary of pLCK MFI normalized to MFI in NT control cells. n = 4 donors, mean ± SD, CD4: TCR + versus TCR8 + : 104 ± 11% versus 173 ± 35%, CD8: TCR + versus TCR8 + : 106 ± 7% versus 126 ± 13%, TCR8 + CD8 versus CD4: 126 ± 13% versus 173 ± 35%. NS, not significant, * P < 0.05. ( F ) Antigen sensitivity measured by IFN-γ ELISpot against peptide-pulsed T2 cells. SFC, spot-forming cells, n = 3 donors, three technical replicates each, mean ± SD, nonlinear regression (curve fit). ( G ) Coculture of NT, TCR + , or TCR8 + CD4 + (red bars) or CD8 + (black bars) T cells with BV173 leukemia cells (HLA-A2*02:01 + survivin + ); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 7. ( H ) Coculture of NT, TCR + , or TCR8 + CD4 + (left) or CD8 + (right) T cells with wild-type (WT) BV173 (solid bars) or β2-microglobulin knockout (B2M-KO) BV173 cells (open bars); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 3. Mean ± SD, *** P < 0.001 and **** P < 0.0001. t test on log-transformed data.

    Article Snippet: In brief, a B2M single-guide RNA (5′–GGCCACGGAGCGAGACAUCU–3′, Synthego) and recombinant Cas9 protein (CP01 and PNA Bio), 1 μg each, were mixed at room temperature and used to electroporate 0.15 × 10 6 BV173 cells (three pulses of 1600 V for 10 ms, Neon Transfection System, Invitrogen).

    Techniques: Retroviral, Marker, Staining, Phospho-proteomics, Control, Enzyme-linked Immunospot, Knock-Out, Transformation Assay